t f p g+ YouTube icon

Intelligent Design and Common Ancestry, Part 4

Bookmark and Share

May 8, 2014 Tags: Genetics, History of Life, Human Origins

Today's entry was written by Dennis Venema. You can read more about what we believe here.

Intelligent Design and Common Ancestry, Part 4

In this brief series, I respond to an attempt by Intelligent Design advocate Casey Luskin to rebut one of my papers – and use it as an opportunity to discuss some interesting biology along the way.

In this final installment of this series, we turn to Luskin’s last argument – his attempt to rebut the evidence for common ancestry from pseudogenes. Pseudogenes are the remnants of genes that persist in genomes after they have acquired mutations that destroy their original function. Given the strength of evidence that they provide for common ancestry, I have written about them on several occasions – most recently as part of my Evolution Basics series.

Perhaps not surprisingly, Luskin once again reaches for his familiar argument. Pseudogenes are functional, he asserts, and thus not evidence for common ancestry. Once again, however, we’ll see that this claim does not hold up to further scrutiny.

Function, function, everywhere (once more, with feeling)!

Luskin’s argument against pseudogenes flows as follows:

  • Evolutionary biologists (whom he calls “Darwinists”) claim that pseudogenes are evolutionary leftovers that have no function.
  • Functions have been found for some pseudogenes.
  • Therefore, pseudogenes cannot be used as evidence for evolution.

The problems with this argument are several, and we will address each of them in turn.

First and foremost, evolutionary biology does not require pseudogenes to be absolutely non-functional. As I have discussed before, evolution actually predicts that some pseudogenes will be found to have a function of some sort. After a gene loses its original function, it is possible that its remaining sequence may be co-opted for a different function. If that function becomes important to its host species over time, it will be maintained through natural selection. There are many examples of this sort of thing known, and Luskin provides a list from the mainstream scientific literature that enumerates several. The observation that a gene has lost its original function, and then picked up a different function, is not an argument against common ancestry, however.

Perhaps an illustration would be useful here. I come from a small, rural town where, as is often the case in rural environments, certain residents have rather eccentric taste in lawn ornaments. One such ornament that sticks in my mind was a toilet bowl used as a flower planter. Now, to be sure, it was a perfectly functional planter – but that new function did nothing to hide the fact that it had been repurposed and no longer served its original function. That original function was perfectly clear, even as it ably performed its new role (though certainly to the chagrin of the neighbors). So too with functional pseudogenes – yes, they’ve picked up a function, and yes, evolution predicts that a fraction of them will. And, as we expect, they bear the marks of once having had a different role – something Luskin neglects to mention.

A second problem with Luskin’s argument is that it sidesteps examples where we know exactly what the original function of the gene in question was, and thirdly, ignores the fact that we see mutations in pseudogenes shared across species. One example is a pseudogene I’ve discussed a few times (see here and here): the remains of the L-gulono lactone oxidase (“GULO”) gene in the human genome. This gene is responsible for making an enzyme needed for vitamin C biosynthesis in mammals. Obviously, humans lack the ability to make their own vitamin C from scratch, and we are thus forced to obtain it in our diet or get scurvy as a result. This defect is unusual for a mammal, but it happens to be shared among primates. Not only is the general defect (i.e. the loss of GULO function) shared among primates, but the molecular details of the loss are shared as well. For example, a functional GULO gene is divided up into twelve segments (exons) in mammals, but humans and other primates happen have the same seven segments deleted entirely:

Functional GULO vs. human, chimpanzee, and macaque GULO (pseudogene)
A schematic diagram of a functional GULO gene compared to the state observed in several crown-group haplorhines for which genome sequence data is available. The same seven exons in humans, chimpanzees, and macaques are deleted from the GULO pseudogene, destroying the function of the enzyme.

Looking more closely at the DNA sequence that remains, we see additional shared mutations in primates. For example, in the remains of exon 12, we see a single DNA letter deletion that is common to humans, chimpanzees, and orangutans:

Human AAAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCC
Chimpanzee AAAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCC
Orangutan AAAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCC
Cow AGAGAAGACCAAAGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCGA
Dog AGAGAAGACCAAGGAGGCCCTGCTGGAACTGAAAGCCATGCTGGAGGCCC
Rat GGAGAAGACCAAGGAGGCCCTACTGGAGCTAAAAGCCATGCTGGAGGCCC
 
Human ACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTG-GAG
Chimpanzee ACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTG-GAG
Orangutan ACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCA-GAG
Cow GCCCCAAGGTAGTGGCCCACTACCCCGTGGAGGTACGCTTCACTCGCGGG
Dog ACCCCAAGATGGTGGCCCACTTCCCTGTGGAGGTCCGCTTCACCCGCGGG
Rat ACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGG
 
Homo sapiensHuman
Pan troglodytesChimpanzee
Pongo pygmaeusOrangutan
Bos taurusCow
Canis lupusDog/Wolf
Rattus norvegicusRat
Functional GULO sequences from cow, dog, and rat compared to nonfunctional sequences in several primates. A portion of exon 12 is shown. Differences from the human sequence are shown in black. Primates share a single nucleotide deletion (highlighted in yellow) in common in this region.

From an evolutionary perspective, the pattern we see for GULO in primates makes perfect sense: the large deletions removing the seven entire exons, as well as the single nucleotide deletion in exon 12, occurred in the common ancestral population of humans, chimpanzees, and orangutans before these species diverged from one another, and each species inherited the same defects from that common ancestral population. To argue otherwise is to argue that these exact mutations happened over and over again in separately designed (i.e., independently created) species. Luskin, however, does not discuss these lines of evidence at all, despite the obvious problem they pose for his argument.

Phylogeny
A phylogeny placing the loss of GULO in the common ancestral population of humans, chimpanzees, gorillas (not shown), and orangutans. Loss in a common ancestral population would place the same genetic defects into all descendent species of that population.

The GULO example, though a well-known one, is far from the only example of a pseudogene with a (a) known function that (b) has shared mutations across primates. A second set of examples I have discussed before are genes responsible in part for the mammalian sense of smell. Primates have many of these genes (called olfactory receptor genes) mutated to pseudogenes, and we share many of these mutations with other primates. As expected, we share the most with chimpanzees, less with gorillas, and less still with orangutans:

Phylogeny

Note too that of the twelve identical mutations we share with chimpanzees, we share nine of these exact same mutations with gorillas; of these nine, six are also shared with orangutans. Note also what we do not observe: a case where humans and orangutans share a mutation (for example) that is not also shared by gorillas and chimpanzees. In other words, if we observe that humans and orangutans share a mutation in common, we can predict with great confidence that gorillas and chimpanzees will have it as well. Likewise, if humans and gorillas share a mutation, we can be confident chimpanzees will have the exact same defect.

Again, this pattern is exactly what common ancestry produces. Luskin, as we have seen, simply does not address this pervasive pattern.

Common ancestry: the best explanation for a coherent pattern of evidence

To summarize this series, the pattern we observe when comparing primate genomes is as follows:

  • We share the highest genome identity with chimpanzees, slightly less so with gorillas, and still less with orangutans, and so on.
  • Likewise, the structural organization (synteny) of our genome most closely matches chimpanzees, then gorillas, then orangutans, and so on.
  • When observing shared mutations in pseudogenes, we share the most with chimpanzees, slightly fewer with gorillas, and still fewer with orangutans, and so on. The set we share with gorillas is a subset of the set we share with chimpanzees, and the set we share with orangutans is a subset of the set we share with gorillas (and chimpanzees).
  • These observations are the expected results of our most recently sharing a common ancestral population with chimpanzees, then gorillas, and then orangutans.

In other words, these lines of evidence converge on a single conclusion: we share ancestry with other apes. Our closest relatives are chimpanzees, then gorillas, then orangutans, and so on. This simple explanation accounts for the pattern we see; moreover, it continues to make accurate predictions about what we should find in our genome, and where we should find it.

What one does not see in Luskin’s argument (nor the anti-common descent ID literature in general) is an attempt to deal with the overall pattern of converging lines of evidence for common ancestry. As we have seen, one will find attempts to shift the human/chimpanzee 95% genome identity value downwards, or attempts to explain shared synteny and shared pseudogenes with appeals to function. What one does not find, however, is an admission that these lines of evidence for human common ancestry converge on the same conclusion, namely that humans are the product of evolution and share ancestry with other forms of life. While seemingly problematic for Luskin, from an Evolutionary Creationist perspective this is not at all troubling: evolution is simply the means by which God brought our species (and others) into being.

For further reading:


Dennis Venema is professor of biology at Trinity Western University in Langley, British Columbia. He holds a B.Sc. (with Honors) from the University of British Columbia (1996), and received his Ph.D. from the University of British Columbia in 2003. His research is focused on the genetics of pattern formation and signaling using the common fruit fly Drosophila melanogaster as a model organism. Dennis is a gifted thinker and writer on matters of science and faith, but also an award-winning biology teacher—he won the 2008 College Biology Teaching Award from the National Association of Biology Teachers. He and his family enjoy numerous outdoor activities that the Canadian Pacific coast region has to offer. Dennis writes regularly for the BioLogos Forum about the biological evidence for evolution.

< Previous post in series


View the archived discussion of this post

This article is now closed for new comments. The archived comments are shown below.

Loading...
Page 1 of 1   1
Steve Sterley - #85383

May 12th 2014

Hey Dennis

I’ve been loving your posts - especially the ones that focus on genetics. Would it be possible to look at ERVs at some point? Or perhaps the evidence from common SINEs or LINEs that we share in identical locations with other apes.

 

Thanks and please keep up the great posts!


PNG - #85398

May 13th 2014

This site has quite a bit on it on those topics:  http://www.evolutionarymodel.com/

I also wrote a bit about such things, and there is a diagram from one of the genome browsers. http://artofthesoluble.blogspot.com/

There was some kind of screwup with Google, and I put this post up, but I can’t get back to it to add or change anything.


dcscccc . - #85407

May 13th 2014

the problem is there is no such a thing “hierarchy tree”. because a lot of base that share between far species are not  share between close one. big problem


dcscccc . - #85405

May 13th 2014

hi steve. actually we find ervs (like herv-k)that contradict the primate tree. and a lot more even with share mutations between far species.

 

 

 

 


Steve Sterley - #85410

May 14th 2014

Hi DCSCCCC

I’ve actually read that paper, have you? If you haven’t, here it is:

http://www.cell.com/current-biology/abstract/S0960-9822(01)00227-5

If you have read the paper then you should know that the authors put their result down (that gorillas and chimps have a large HERV-K insertion that humans don’t) to incomplete lineage sorting.

The maths for this effect was worked out in the early 1980s, long before these genomes were sequenced.

If you’d like to better understand ILS, Dennis has done a great post on it here:

http://biologos.org/blog/evolution-basics-incomplete-lineage-sorting-and-ancestral-population-sizes

Also be sure to read about it here:

http://www.pandasthumb.org/archives/2012/03/a-tiny-bit-of-k.html

If you will read the comments to this last post you will see that a back of the envelope calculation predicts that humans and chimps will be most similar 60% of the time and that chimps and gorillas will be most similar 20% of the time.


dcscccc . - #85415

May 14th 2014

i steve


dcscccc . - #85416

May 14th 2014

i steve. the ils model prove that evolution cant be test, any


dcscccc . - #85406

May 13th 2014

oops. look down.


Steve Sterley - #85399

May 13th 2014

Neat, thanks

 

I’ll give that a look.


dcscccc . - #85402

May 13th 2014

hi dr venema. sorry for my english. .you said that commondescent predict share mutations between species. according to this logic- if we will see for exmaple 10 mutations share between gorila and human but not chimp then commondescent is falsified?

 


Page 1 of 1   1